View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_high_26 (Length: 228)
Name: NF9930_high_26
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_high_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 44371128 - 44371358
Alignment:
| Q |
1 |
caccgttggatataatgttgattacttctactaaaccattagttacattcccttcatatcttcaagtaagtctacttagtgcatgtttagattgacagta |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44371128 |
caccgttggatataatgttgattaattctactaaaccatcagttacattgccttcatatcttcaagtaagtctat------catgtttagattgacagta |
44371221 |
T |
 |
| Q |
101 |
aatttagtataatcacgcatttttaacaaatgctacaatatagcgatgtgatttcatcaaactcgtcatgat---------tgcacttaggttcggtaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
44371222 |
aatttagtataatcacgcatttttaacaaatgctactatatagcgatgtgatttcatcaaactcatcatgattccaacccatgcacttaggttctgtaaa |
44371321 |
T |
 |
| Q |
192 |
atcatgataagacaaacaaagggggtgattcattttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371322 |
atcatgataagacaaacaaagggggtgattcattttg |
44371358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University