View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_high_29 (Length: 209)
Name: NF9930_high_29
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_high_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 34033831 - 34034033
Alignment:
| Q |
7 |
gagaagcaaagggttgagttcgaggcttcacagtctcagcttgaaattgttgacaagttgaaccaaggactaagagatcagaaacaggaccaggctttcg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033831 |
gagatgcaaagggttgagttcgaggcttcacagtctcagcttgaaattgttgacaagttgaaccaaggactaagagatcagaaacaggaccaggctttcg |
34033930 |
T |
 |
| Q |
107 |
caaatgacatacttgaggagattgcaagggcagttggcgtgccggtggaaccgtccgagataggaaaagagttggccagcattaggaaggaaaaagaaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033931 |
caaatgacatacttgaggagattgcaagggcagttggcgtgccggtggaaccgtccgagataggaaaagagttggccagcattaggaaggaaaaagaaga |
34034030 |
T |
 |
| Q |
207 |
agc |
209 |
Q |
| |
|
||| |
|
|
| T |
34034031 |
agc |
34034033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University