View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_low_12 (Length: 309)
Name: NF9930_low_12
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 17 - 291
Target Start/End: Original strand, 21429153 - 21429426
Alignment:
| Q |
17 |
acatagaagaagaggtgaatcaggacaaggataatgaagttcctaccctcgggagcaattgggaggaacatatgaaacacaaccttcgtctgaatctctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21429153 |
acatagaagaagaggtgaatcaggacaaggataatgaagttcctaccctcgggagcaattgggaggaacatatgaaacacaaccttcgtctgaatctctg |
21429252 |
T |
|
| Q |
117 |
tgaccacatttatttgggccgaacgaacatttatccttttttagaatagttttttaacacatttatttgggcaaaccaaaattttgaccaatgtaattac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21429253 |
tgaccacatttatttgggccgaacgaacatttatccttttttagaatagttttttaacacatttatttgggcaaaccaaaattttgaccaatgtaattga |
21429352 |
T |
|
| Q |
217 |
tttaaaatagctaacaaaacttatctagagattttacaatgaaatttttgttgcaatatctaatctaaggacagg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21429353 |
tttaaaatagctaacaaaacttatctagaga-tttacaatgaaatttttgttgcaatatctaatctaaggacagg |
21429426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 17 - 115
Target Start/End: Complemental strand, 30287009 - 30286909
Alignment:
| Q |
17 |
acatagaagaagaggtgaatcaggacaaggataatgaagttcctaccctc--gggagcaattgggaggaacatatgaaacacaaccttcgtctgaatctc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| || ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30287009 |
acatagaagaagaggtgaatcaggacaaggacaatgaagttccaacgctcaggggagcaattgggaggaacatatgaaacacaaccttcatctgaatctc |
30286910 |
T |
|
| Q |
115 |
t |
115 |
Q |
| |
|
| |
|
|
| T |
30286909 |
t |
30286909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University