View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_low_14 (Length: 292)
Name: NF9930_low_14
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_low_14 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 1877116 - 1877392
Alignment:
| Q |
16 |
gatttgattgtgtttggtgcatgcccaggttatagagaggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1877116 |
gatttgattgtgtttggtgcatgcccaggttatagagaggtggaggatggtttattttgttggtagctcgaaggtggattgctagtttcatttggtatca |
1877215 |
T |
 |
| Q |
116 |
tatttttctgttagtgggaacgagtgtaatcttgcccagtattatatttttctataaagagaagtctaatgctaatttgatacaccatacaaccgtttga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
1877216 |
tatttttctgttagtgggaacgagtgtaatcttgcccagtattatatttttctataaagagaagtctaatgcttatttgatacaccacacaaccgtttga |
1877315 |
T |
 |
| Q |
216 |
aagattttaggggtatataatgacgttattttttcttcaaaatcttatagggcccatgacttggtataggatatcat |
292 |
Q |
| |
|
|| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1877316 |
aaaattttaggggtatataatgacattattttttcttcaaaatcttatagggcccatgacttggtatatgatatcat |
1877392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University