View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_low_24 (Length: 248)
Name: NF9930_low_24
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 43188280 - 43188173
Alignment:
| Q |
124 |
ggatttcagaagtggtggaatggaagctagatccctatatccatccggattccaaataggaacaaatgatgctaacatgttttattgaacgctaactgat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43188280 |
ggatttcagaagtggtggaatggaagctagatccctatatccatccggattccaaataggaacaaatgatgctaacatgttttattgaacgccaactgat |
43188181 |
T |
|
| Q |
224 |
gaaagaat |
231 |
Q |
| |
|
|||||||| |
|
|
| T |
43188180 |
gaaagaat |
43188173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 43188358 - 43188281
Alignment:
| Q |
1 |
gttttgtgtgttcatgtacgcaaaggttggccgtgatgtgacacaaagaccgactataacagtaaaggagtgctggtg |
78 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43188358 |
gttttgtgcgttcatgtacgcaaaggttggccgtgatgtgacacaaagaccgactatcacagtaaaggagtgctggtg |
43188281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University