View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_low_28 (Length: 236)
Name: NF9930_low_28
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 37386406 - 37386312
Alignment:
| Q |
35 |
tgatgtatcggatttaaaattaaacaaacacgttaatttttgttgatctagctttttcttatacataggaacgaaggaagtatattcttagagtc |
129 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
37386406 |
tgatgtatcagatttaaaattaaacaaacacgttaattttttttgatctagctttttcttatatataggatcgaaggaagtatattcttagagtc |
37386312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University