View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9930_low_34 (Length: 209)

Name: NF9930_low_34
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9930_low_34
NF9930_low_34
[»] chr1 (1 HSPs)
chr1 (7-209)||(34033831-34034033)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 34033831 - 34034033
Alignment:
7 gagaagcaaagggttgagttcgaggcttcacagtctcagcttgaaattgttgacaagttgaaccaaggactaagagatcagaaacaggaccaggctttcg 106  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34033831 gagatgcaaagggttgagttcgaggcttcacagtctcagcttgaaattgttgacaagttgaaccaaggactaagagatcagaaacaggaccaggctttcg 34033930  T
107 caaatgacatacttgaggagattgcaagggcagttggcgtgccggtggaaccgtccgagataggaaaagagttggccagcattaggaaggaaaaagaaga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34033931 caaatgacatacttgaggagattgcaagggcagttggcgtgccggtggaaccgtccgagataggaaaagagttggccagcattaggaaggaaaaagaaga 34034030  T
207 agc 209  Q
    |||    
34034031 agc 34034033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University