View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9931_5 (Length: 328)
Name: NF9931_5
Description: NF9931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9931_5 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 124 - 328
Target Start/End: Complemental strand, 4319526 - 4319323
Alignment:
| Q |
124 |
gaatttagacgatgaaaaaagtggaagattgaaaatatttaataaaaggaaaaatggctcatcttacggaatgaaactattcgggtgcagtcgtgcttgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4319526 |
gaatttagacgatgaaaaaagtggaagattgaaaatatttaataaaaggaaaaatggctcatcttacggaatgaaactattagggtgcagtcgtgcttgt |
4319427 |
T |
 |
| Q |
224 |
tggtctttgtaccaacaaggattttccatatatggaattggcagcaataacggcatgacacagtaactatgaccgaccatctgattttaaaatcaatggt |
323 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
4319426 |
tggtcttcgtaccaacaaggattttccatatatggaattggcggcaataacgacatgacacagtaactatgactgaccatctgatttt-aaatcgatggt |
4319328 |
T |
 |
| Q |
324 |
cgaga |
328 |
Q |
| |
|
||||| |
|
|
| T |
4319327 |
cgaga |
4319323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 4319713 - 4319626
Alignment:
| Q |
19 |
tgtgtacatatctgcagattgtagggaacttatctctcgtatttttgttgccaatccagctaaggtaaatattagtcttaattctctc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
4319713 |
tgtgcacatatctgcagattgtagggaacttatctctcgtatttttgttgccaatccagcttaggtaaatattagtcttaactctctc |
4319626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University