View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9933_low_2 (Length: 201)
Name: NF9933_low_2
Description: NF9933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9933_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 54022988 - 54022912
Alignment:
| Q |
17 |
gagttagaatgattcttaaactggttatccatggcatacacaagtctagtccttgtgccaatgcaattcatattata |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
54022988 |
gagttagaatgattcttaaactggttatccatggcacacacaagtttagtccttgtgccgatgcaattcatattata |
54022912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 133 - 186
Target Start/End: Complemental strand, 54022916 - 54022863
Alignment:
| Q |
133 |
ttataatccaaataaacaaacacttttggattttataatttgaaggttccatgt |
186 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
54022916 |
ttataatccaaatgaacatacacttatggattttataatttgaaggttccatgt |
54022863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 144
Target Start/End: Complemental strand, 26610642 - 26610606
Alignment:
| Q |
108 |
agggtgtatatgggatgtttgaattttataatccaaa |
144 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
26610642 |
agggtgtatataggatgttagaattttataatccaaa |
26610606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University