View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9934_low_2 (Length: 390)
Name: NF9934_low_2
Description: NF9934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9934_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 372
Target Start/End: Original strand, 18787176 - 18787537
Alignment:
| Q |
11 |
tgttggtggtacaagtcatgttcagcatctactatgtggtgtaaaccttcccgaaaaggtaaaattctgttggttaattattaaacgaatttctgatcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
18787176 |
tgttggtggtacaagtcatgttcagcatctactatgtggtgtaaaccttcccgaaaaggtaaaattttgttggttaata--taaacgaatttctgatcaa |
18787273 |
T |
|
| Q |
111 |
gaaaatttgttagctaacgacaaaatcgattaggatggacaaaaggaaggatataagaaatgtgacttatattacctaatactacgagggtttaggttgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18787274 |
gaaaatttgttagctaacgacaaaatcgattaggatggacaaaaggaaggttataagaaatgtgacttatattacctaatactacgagggtttaggttgc |
18787373 |
T |
|
| Q |
211 |
aatatgctatcttggtctcttgtggtcttggtcattttagtaaca--ctcgatacttcctgaagaccattccatttgttttgcagactatctttgaaaat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18787374 |
gatatgctatcttggtctcttgtggtcttggtcattatcgtaacactctcgatacttcctgaagacaattccatttgttttgcagactatctttgaaaat |
18787473 |
T |
|
| Q |
309 |
gacataaatgagacggtactttggcatgatcaaagtcagcaatataatcgttttgggaggtacg |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
18787474 |
gacataaatgagacggtactttggcatgatcaaagtcagcaatatagttgttttgggaggtacg |
18787537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University