View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_high_17 (Length: 328)
Name: NF9935_high_17
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 55016070 - 55015762
Alignment:
| Q |
1 |
gaatgctacaaatggtgagtctgcaattactcatcacttcaacaaaaccattttcatgtgcttcattttggatccttctcatgtgagcttccatggccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55016070 |
gaatgctacaaatggtgagtctgcaattactcatcacttcaacaaaaccattttcatgtgcttcattttggatccttctcatgtgagcttccatggccca |
55015971 |
T |
 |
| Q |
101 |
ttttctgatccaactgcactgttttactctaagtggtgatatcatctccgtcacaaggttgcggcggagggagcgccagagtgggccgtattcggcagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55015970 |
ttttctgatccaactgcactgttttactctaagtggtgatatcatctccgtcacaaggttgcggcggagggagcgccagagtgggccgtattcagcagag |
55015871 |
T |
 |
| Q |
201 |
ttgatggcacactttcccatgctgaagatgagacgaatgggagagtctttaggcctgcttgcaaactgtgggcctcgttggattagggcttcatggatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015870 |
ttgatggcacactttcccatgctgaagatgagacgaatgggagagtctttaggcctgcttgcaaactgtgggcctcgttggattagggcttcatggatga |
55015771 |
T |
 |
| Q |
301 |
ggtcagcct |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
55015770 |
ggtcagcct |
55015762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University