View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_high_33 (Length: 215)
Name: NF9935_high_33
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 7660456 - 7660635
Alignment:
| Q |
18 |
agataaatggaaatggaacaactgtacaaggatacgtgtttggttaagaatgctggttctattggttcggaaatgttaatgataatatagtatttattta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7660456 |
agataaatggaaatggaacaactgtacaaggatacgtgtttggttaagaatgctggttctattggttcggaaatgttaatgataatatagtatttactta |
7660555 |
T |
|
| Q |
118 |
gttacagcacattacatgatatattccttttatgaaggaagtgatggtcaactactatatagaattatggatattactat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7660556 |
gttacagcacattacatgatatattccttttatgaaggaagtgatggtcaactactatatagaattatagatattactat |
7660635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 180
Target Start/End: Original strand, 7663125 - 7663154
Alignment:
| Q |
151 |
gaaggaagtgatggtcaactactatataga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7663125 |
gaaggaagtgatggtcaactactatataga |
7663154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University