View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_24 (Length: 284)
Name: NF9935_low_24
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 36466296 - 36466032
Alignment:
| Q |
1 |
aggttataaattcttctaaatttggttgaacttttaaaatgttcattcataaaaattattaagcaagggtttggaccttttggttacaccttaattctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
36466296 |
aggttataaattcttctaaatttggttgaacttttaaaatgttcattcataaaaattattaagcaagggtttggaccttttggttacaccttaatcccct |
36466197 |
T |
 |
| Q |
101 |
ccctcatttaaaaatataattttaaaaacttcttcaaccataaatttagatgatccttgctacattcgagatatattaagtaaatatatacttcata-nn |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36466196 |
ccctcatttaaaaatataattttaaaaacttcttcaaccataaatttagatgatccttgctacattcaagatatattaagtaaatatatacttcatatat |
36466097 |
T |
 |
| Q |
200 |
nnnnnnnnnnnnnattattgtgttatttcatattaaataactacataactatatcttgtcaaagt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36466096 |
ttttttattttttattattgtgttatttcatattaaataactacataactatatcttgtcaaagt |
36466032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University