View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_25 (Length: 281)
Name: NF9935_low_25
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 62 - 242
Target Start/End: Complemental strand, 41305368 - 41305188
Alignment:
| Q |
62 |
aaaactatggcttcttcatttgatgagacaaaattatggggatgttttctggtatcaattggatctattttctttgctggttacttctttcttgctcttt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305368 |
aaaactatggcttcttcatttgatgagacaaaattatggggatgttttctggtatcaattggatctattttctttgctggttacttctttcttgctcttt |
41305269 |
T |
 |
| Q |
162 |
tttccaagcttcttcctccttctcaaattccactcatcccttcctttcaaaatgactggtcagtaatttattctatcattc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305268 |
tttccaagcttcttcctccttctcaaattccactcatcccttcctttcaaaatgactggtcagtaatttattctatcattc |
41305188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 41305438 - 41305393
Alignment:
| Q |
19 |
aagtttggcaaggacctagaggggaaactgatcatatattctcaaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305438 |
aagtttggcaaggacctagaggggaaactgatcatatattctcaaa |
41305393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 90 - 221
Target Start/End: Original strand, 1073904 - 1074035
Alignment:
| Q |
90 |
caaaattatggggatgttttctggtatcaattggatctattttctttgctggttacttctttcttgctcttttttccaagcttcttcctccttctcaaat |
189 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| || |||||| ||||||||||||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
1073904 |
caaaattatggggatggttattggtatcaattggatcacttctctttgttggttacttctttcttgctcttttttcaaagcttcttcctccttccaataa |
1074003 |
T |
 |
| Q |
190 |
tccactcatcccttcctttcaaaatgactggt |
221 |
Q |
| |
|
|| ||||| ||||||| ||||||||||||| |
|
|
| T |
1074004 |
ccctttcatctcttccttccaaaatgactggt |
1074035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 90 - 221
Target Start/End: Complemental strand, 1096911 - 1096780
Alignment:
| Q |
90 |
caaaattatggggatgttttctggtatcaattggatctattttctttgctggttacttctttcttgctcttttttccaagcttcttcctccttctcaaat |
189 |
Q |
| |
|
||||||| |||||||| || ||||||||||||| |||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
1096911 |
caaaattttggggatggttattggtatcaattggttctattctctttgttggttacttctttcttgctcttttttcaaagcttcttcctccttccaacaa |
1096812 |
T |
 |
| Q |
190 |
tccactcatcccttcctttcaaaatgactggt |
221 |
Q |
| |
|
|| ||||| ||||||| ||||||||||||| |
|
|
| T |
1096811 |
ccctttcatctcttccttccaaaatgactggt |
1096780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University