View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_30 (Length: 255)
Name: NF9935_low_30
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 99 - 243
Target Start/End: Complemental strand, 42983056 - 42982912
Alignment:
| Q |
99 |
cgggttttgattcgggtgtgaagcttgagtctgattgcatgtatccgtttacttcttcaagtagcgttttgcagagaaaaattaaactgcaatatgatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983056 |
cgggttttgattcgggtgtgaagcttgaatctgattgcatgtatccgtttacttcttcaagtagcgttttgcagagaaaaattaaactgcaatatgatga |
42982957 |
T |
|
| Q |
199 |
gcttgttaaaagtaatgaatccaagaaattgactctgccacaggt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982956 |
gcttgttaaaagtaatgaatccaagaaattgactctgccacaggt |
42982912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University