View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_35 (Length: 250)
Name: NF9935_low_35
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 40104422 - 40104190
Alignment:
| Q |
1 |
ggcctttgtaaatccaatcaatgaaatttatgtaatattgtaaatagattacaaaattataaagtagttttcaaagttctcattgctgaaatccctcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40104422 |
ggcctttgtaaatccaatcaatgaaatttatgtaatattgtaaatagattacaaaattataaagtagttttcaaagttctcattgctgaaatccctcttt |
40104323 |
T |
 |
| Q |
101 |
tatgtgttattttcactttgaaatattccattgctgctcattctcatttgtatagtaatataaacctctagagttgggttggtgaaccgttggctttaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40104322 |
tatgtgttattttcactttgaaatattccattgctgctcattctcatttgtatagtaatataaacctctagagttgggttggtgaaccgatggctttaga |
40104223 |
T |
 |
| Q |
201 |
cctaggagtatgtttctttatgcatcttagttc |
233 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
40104222 |
cctaggagtatgtttctttctgcatcttagttc |
40104190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University