View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_37 (Length: 239)
Name: NF9935_low_37
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 76 - 224
Target Start/End: Original strand, 7542990 - 7543138
Alignment:
| Q |
76 |
aaaaaattaagctgaggatttaatatgtctattttgtgtgaagatctaaagaaattacgtactacttatgcattaatgtgtctgaattaatagttttgat |
175 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542990 |
aaaaaattaagctgtggatttaatatgtctattttgtgtgaagatctaaagaaattacgtactacttatgcattaatgtgtctgaattaatagttttgat |
7543089 |
T |
 |
| Q |
176 |
ttgcttttgacaactacatcgattgaaagtagtttatctccaatgaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7543090 |
ttgcttttgacaactacatcgattgaaagtagtttatctccaatgaatt |
7543138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 7542795 - 7542858
Alignment:
| Q |
1 |
atcatacttctctaacaagatatgtgtaattaaaaaggatagcaattgtatgatatgtgaagat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542795 |
atcatacttctctaacaagatatgtgtaattaaaaaggatagcaattgtatgatatgtgaagat |
7542858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University