View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9935_low_38 (Length: 238)
Name: NF9935_low_38
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9935_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 7002539 - 7002316
Alignment:
| Q |
1 |
cgctttgaagtcgaagaaatatgcatgttgtgtgctcttcatctttcatttcatttttgtagnnnnnnntatttttaaaaataatgatgtgcgatctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7002539 |
cgctttgaagtcgaagaaatatgcatgttgtgtgctcttcatctttcatttcatttttgtagaaaaaaatatttttaaaaataatgatgcgcgatctttt |
7002440 |
T |
 |
| Q |
101 |
tgatttaaattcttttgattgatatcatgatcgctctttcattttctttcatatggggattcttaaaaatgatgctttcaacatattgaaagttttccta |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7002439 |
ttatttaaattcttttgattgatatcatgatcgctctttcattttctttcatatggtgattcttaaaaatgatgctttcaacatattgaaagttttccta |
7002340 |
T |
 |
| Q |
201 |
taaataagttgatcggagaattat |
224 |
Q |
| |
|
|||||||| |||| ||| |||||| |
|
|
| T |
7002339 |
taaataagctgattggaaaattat |
7002316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University