View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9935_low_42 (Length: 215)

Name: NF9935_low_42
Description: NF9935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9935_low_42
NF9935_low_42
[»] chr5 (2 HSPs)
chr5 (18-197)||(7660456-7660635)
chr5 (151-180)||(7663125-7663154)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 7660456 - 7660635
Alignment:
18 agataaatggaaatggaacaactgtacaaggatacgtgtttggttaagaatgctggttctattggttcggaaatgttaatgataatatagtatttattta 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
7660456 agataaatggaaatggaacaactgtacaaggatacgtgtttggttaagaatgctggttctattggttcggaaatgttaatgataatatagtatttactta 7660555  T
118 gttacagcacattacatgatatattccttttatgaaggaagtgatggtcaactactatatagaattatggatattactat 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
7660556 gttacagcacattacatgatatattccttttatgaaggaagtgatggtcaactactatatagaattatagatattactat 7660635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 180
Target Start/End: Original strand, 7663125 - 7663154
Alignment:
151 gaaggaagtgatggtcaactactatataga 180  Q
    ||||||||||||||||||||||||||||||    
7663125 gaaggaagtgatggtcaactactatataga 7663154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University