View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_high_21 (Length: 299)
Name: NF9936_high_21
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_high_21 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 103 - 283
Target Start/End: Complemental strand, 13126231 - 13126051
Alignment:
| Q |
103 |
ttacccgaacactctctagtctctaattctatcatcatatacaattttacaacacatccaacgcaagatcctcatctctattacgcttagttcatgacca |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13126231 |
ttaccccaacactctctagtctctaattctatcatcatgtaaaattttaccacacatccaacgcaagatcctcatctctattacgcttagttcatgacca |
13126132 |
T |
 |
| Q |
203 |
atttgtacaatacaataaacacttttagcacaagcaaaatgaaaaacagaaagagggaaaaaggggggaaattgagggagt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
13126131 |
atttgtacaatacaataaacacttttagcacatgcataatgaaaaacacaaagagtgaaaaaggggggaaattgagggagt |
13126051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 11 - 128
Target Start/End: Complemental strand, 13126391 - 13126274
Alignment:
| Q |
11 |
caaaggaagtatcgttcgaaagaacccaaatttgattcctgtgcggaacaatttttggccaaaccatacatacctcacacccgaactccagattacccga |
110 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13126391 |
caaaggacgtatcgttcgagagaacccaaatttgattcctgtgcggaacaatttttggtcaaaccatacatacctcacacccgaactccagattacccca |
13126292 |
T |
 |
| Q |
111 |
acactctctagtctctaa |
128 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13126291 |
acactctctagtctctaa |
13126274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 149 - 191
Target Start/End: Complemental strand, 54470160 - 54470118
Alignment:
| Q |
149 |
ttacaacacatccaacgcaagatcctcatctctattacgctta |
191 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
54470160 |
ttaccacacatccaatgcaacatcctcatctctattacgctta |
54470118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 105
Target Start/End: Complemental strand, 92667 - 92606
Alignment:
| Q |
44 |
gattcctgtgcggaacaatttttggccaaaccatacatacctcacacccgaactccagatta |
105 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||| |||||| || ||||||||||||||| |
|
|
| T |
92667 |
gattcctgtgtagaacaatttttggccagactttacttacctctcaaccgaactccagatta |
92606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University