View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_high_25 (Length: 265)
Name: NF9936_high_25
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 22836924 - 22837157
Alignment:
| Q |
19 |
ctctttccatcagtgattcatgtatgtgtcttttcatcgatggatggttcgcagtcactgtaacggtgctccgttgcatgactgatgctttgcacttttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22836924 |
ctctttccatcagtgattcatgtatgtgtcttttcatcgatggatggttcgcagtcactgtaacggtgctccgttgcatgactgatgctttgcacttttg |
22837023 |
T |
|
| Q |
119 |
gaatattttcctccgcttcaagaccgcgaaacgcagctcacttacatttgctagtcattcggccaccgcggatggccgccgcttggtcgctcttgcttat |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837024 |
gaatattttcctccgcttcaagacggcgaaacgcagctcacttacatttgccagccattcggccaccgcggatggccgccgcttggtcgctcttgcttat |
22837123 |
T |
|
| Q |
219 |
cttaagtcccgccgtggcttcttctttgacctct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22837124 |
cttaagtcccgccgtggcttcttctttgacctct |
22837157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University