View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_high_26 (Length: 253)
Name: NF9936_high_26
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 39681962 - 39681727
Alignment:
| Q |
1 |
ttcttatgattgatgtgtgtatgttattgtgacgattcttgattaggtgcaaaggtgggaattaggtgccaagaccggaagactatggacgaagttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39681962 |
ttcttatgattgatgtgtgtatgttattgtgacgattcttgattaggtgcaaaggtgggaattaggtgccaagaccggaagactatggacgaagttttct |
39681863 |
T |
 |
| Q |
101 |
acacagaaggagtgacagattccacaggaacatacaacataatggttgagaatgaccaccatgacaatatttgcaaaactgtgcttgttagcagcccgat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39681862 |
acacggaaggagtgacagattccacaggaacatacaacataatggttgagaatgaccaccatgacaatatttgcaaaactgtgcttgttagcagcccaat |
39681763 |
T |
 |
| Q |
201 |
atcatcgtgtaatacacctgaccctgggcgtaacag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39681762 |
atcatcgtgtaatacacctgaccctgggcgtaacag |
39681727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University