View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_high_27 (Length: 250)
Name: NF9936_high_27
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 31171823 - 31172062
Alignment:
| Q |
11 |
caaaggagttgaattaaggaaagacaattgaatcaaaatgtggtaagcatatgctaaatattaagctatcatagttacactgacatagatagaactgttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31171823 |
caaaggagttgaattaaggaaagacaattgaatcaaaatgtggtaagtatatgctaaatattaagctataatagttacactgacatagatagaactgttt |
31171922 |
T |
 |
| Q |
111 |
gttctcgtctgaaaacacaagtctaggtccccgtttctgttcaagttgagtgacacccttaattggaggataacctagtactttaagaattgtgtagagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171923 |
gttctcgtctgaaaacacaagtctaggtccccgtttctgttcaaggtgagtgacacccttaattggaggataacctagtactttaagaattgtgtagagt |
31172022 |
T |
 |
| Q |
211 |
ctctctttttctctctgcctttatccttttatatgtgtcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31172023 |
ctctctttttctctctgcctttatccttttatatgtgtcc |
31172062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University