View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_low_24 (Length: 300)
Name: NF9936_low_24
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 1215803 - 1215509
Alignment:
| Q |
1 |
ccccctctacaagcaactataaataacccctttgatttggtggaggatatatatttcatacaccttcacacttctctatattgcttccaatttcattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1215803 |
ccccctctacaagcaactataaataacccctttgatttggtggaggatatatatttcatacaccttcacacttctctatattgcttccaatttcattgtt |
1215704 |
T |
 |
| Q |
101 |
cttgatttgtctccaatattatatacatagagaacgatgaaaggggtatggaatggagtacatggtttgaaaccagtgattcttatggtgttggttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1215703 |
cttgatttgtctccaatattatatacatagagaacgatgaaaggggtatggaatggagtacatggtttgaaaccagtgattcttatggtgttggttcaaa |
1215604 |
T |
 |
| Q |
201 |
ttgcatatgctgctgtcaatgtgctttacaaacttgccatcaatgatggaatgactgttaaagttgccactgcttaccgtcttgcctttgcttct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
1215603 |
ttgcatatgctgctgtcaatgtgctttacaaacttgccatcaatgatggaatgactgttaaagttgccactgcttaccgtcttgcttttggttct |
1215509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 283
Target Start/End: Complemental strand, 9849971 - 9849873
Alignment:
| Q |
185 |
atggtgttggttcaaattgcatatgctgctgtcaatgtgctttacaaacttgccatcaatgatggaatgactgttaaagttgccactgcttaccgtctt |
283 |
Q |
| |
|
|||||| |||| |||||| ||| |||| |||| |||||||| |||||||||||||| || |||||||||| ||| ||||| | | ||||||||||||| |
|
|
| T |
9849971 |
atggtgatggtgcaaatttcatttgcttctgtgaatgtgctctacaaacttgccattaacgatggaatgaatgtcaaagtacctattgcttaccgtctt |
9849873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University