View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9936_low_29 (Length: 265)

Name: NF9936_low_29
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9936_low_29
NF9936_low_29
[»] chr8 (1 HSPs)
chr8 (19-252)||(22836924-22837157)


Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 22836924 - 22837157
Alignment:
19 ctctttccatcagtgattcatgtatgtgtcttttcatcgatggatggttcgcagtcactgtaacggtgctccgttgcatgactgatgctttgcacttttg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22836924 ctctttccatcagtgattcatgtatgtgtcttttcatcgatggatggttcgcagtcactgtaacggtgctccgttgcatgactgatgctttgcacttttg 22837023  T
119 gaatattttcctccgcttcaagaccgcgaaacgcagctcacttacatttgctagtcattcggccaccgcggatggccgccgcttggtcgctcttgcttat 218  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||    
22837024 gaatattttcctccgcttcaagacggcgaaacgcagctcacttacatttgccagccattcggccaccgcggatggccgccgcttggtcgctcttgcttat 22837123  T
219 cttaagtcccgccgtggcttcttctttgacctct 252  Q
    ||||||||||||||||||||||||||||||||||    
22837124 cttaagtcccgccgtggcttcttctttgacctct 22837157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University