View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9936_low_34 (Length: 224)
Name: NF9936_low_34
Description: NF9936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9936_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 30252145 - 30252327
Alignment:
| Q |
19 |
cagagaacggtttccaattccttcaataggttgattcgaagtttggttgaatcttcttctgcgtttgcgtcattgtttcgagtgggttctgatatgaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30252145 |
cagagaacggtttccaattccttcaataggttgattcgaagtttggttgaatcttcttctgcgtttgcgtcgttgtttcgagtgggttctgatatgaata |
30252244 |
T |
|
| Q |
119 |
gattgatcatttttcgacggtggagtttcagtgaatggagggttttgagtttgggaattttgaaagaaatgaagggaagttcg |
201 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30252245 |
ggttgatcatttttcgacggtggagtttcagtgaatggagggttttgagtttgggaattttgaaagaaatgaagggaagttcg |
30252327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University