View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9937_low_19 (Length: 312)
Name: NF9937_low_19
Description: NF9937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9937_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 37779466 - 37779164
Alignment:
| Q |
1 |
ccataacttttacctctctggttgcaatgatctctttctctatctaatcgtcttctttttctcaccaaccatttttctaagttttaacaaaataaaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37779466 |
ccataacttttacctctctggttgtaatgatctctttctctatctaatcgtcttctttttctcaccaaccatttttctaagttttaacaaaataaaaaat |
37779367 |
T |
|
| Q |
101 |
aatagaaaacaatgtgctttcagtttattcattctttcctcttttttacatcttcataatctaaatagacgaatgctttcatttttattaaattatggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37779366 |
aatagaaaacaatgtgctttcagtttattcattctatcctcttttttatatcttcataatctaaatagacgaatgctttcatttttattaaattatgg-- |
37779269 |
T |
|
| Q |
201 |
cagagcatgtttacagattatctcttcgtgcccttgcaaatatattaatttatcgacacattaatatttgtgaatatcaaataccaaaatcatttataac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37779268 |
---agcatgtttacagattatctcttcgtgcccttgcaaatatattaatttatcgacacattaatatttgtgaatatcaaataccaaaatcatttataac |
37779172 |
T |
|
| Q |
301 |
acgaaact |
308 |
Q |
| |
|
| |||||| |
|
|
| T |
37779171 |
atgaaact |
37779164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University