View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9937_low_22 (Length: 261)
Name: NF9937_low_22
Description: NF9937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9937_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 31389148 - 31389280
Alignment:
| Q |
8 |
atatcgcaacatcgaaggactagaaaagggtggtgcatagaaggaaggttctcattgcactaccattagaaactattaaatcttggtggctgatatttgg |
107 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31389148 |
atatcgcatcaccgaaggactagaaaagggtggtgcatagaaggaaggttttcatcgcactaccattagaaactattaaatcttggtggctgagatttgg |
31389247 |
T |
 |
| Q |
108 |
atcaaaagggtaaggccggtggaggggttagctt |
141 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
31389248 |
atcaaaagggtaagg-cggtggaggggttagctt |
31389280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University