View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9937_low_24 (Length: 247)
Name: NF9937_low_24
Description: NF9937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9937_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 14329314 - 14329430
Alignment:
| Q |
108 |
tacaatgtacctttgcaacttctggaagcaattatgggtcatttgtttattgcttgaagttatcagtggtcaaatatagtgcagagaagcaaaaggacaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14329314 |
tacaatgtacctttgcaacttctggaagcaattatgggtcatttgtttattgcttgaagttatcagtggccaaatatagtgcagagaagcaaaaggacaa |
14329413 |
T |
 |
| Q |
208 |
aacttacctacattact |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14329414 |
aacttacctacattact |
14329430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 14329207 - 14329253
Alignment:
| Q |
1 |
atcccaaactttatctggttttaaatgtgaataataaataacctcac |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14329207 |
atcccaaactttatctggttttaaatgtgaataataaataacctcac |
14329253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University