View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9938_high_7 (Length: 249)
Name: NF9938_high_7
Description: NF9938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9938_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 38932697 - 38932474
Alignment:
| Q |
5 |
taaataaagagaaatgaaacagacttgatggagattgtgaggagaatcggagaccatggatgctccttgttgtgatcttgtatggtgagttgagcgagtt |
104 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
38932697 |
taaatagagagaaatgaaagagactcgatggagattgtgaggagaatcggaaaccatggatgctcgttgttgtgatcttgtatgctgagttgagcgagtt |
38932598 |
T |
|
| Q |
105 |
gagcaacgattgagag----taactgtggacgcacggttttagaaatggaattgggtggacgcatcttccactttggattatgtatcttttttgagtggg |
200 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38932597 |
gatcaacgattgagagagagtaactgtggacgcacggttttagaaatgaaattgggtggacgcatcttccactttggattatgtaccttttttgagtggg |
38932498 |
T |
|
| Q |
201 |
gtcatctctttacagtattattcc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38932497 |
gtcatctctttacagtattattcc |
38932474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University