View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9938_low_10 (Length: 253)
Name: NF9938_low_10
Description: NF9938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9938_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 29548274 - 29548508
Alignment:
| Q |
19 |
aaggttaatggagtcagcgtgcaaaagcaccttttagtgataaaacactaagatttttcatcagagatactcccaacaaaaggattggaataaaattgag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
29548274 |
aaggttaatggagtcagcgtgcaaaagcaccttttagtgataaaacactaagatttttcatcagagatactcccaacgaaaggagaggaataaaattgag |
29548373 |
T |
 |
| Q |
119 |
aaacttgctacagcagatggccaaatcactgaaaatacatatcagattgggagggatccagctcccatgcagtcaacattgctcgcattcactcaatcgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548374 |
aaacttgctacagcagatggccaaatcactgaaaatacatatcagattgggagggatccagctcccatgcagtcaacattgctcgcattcactcaatcgg |
29548473 |
T |
 |
| Q |
219 |
aacattggtggacattcaatcaagattaagctgtc |
253 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29548474 |
aacattgttggacattcaatcaagattaagctgtc |
29548508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University