View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9938_low_15 (Length: 237)
Name: NF9938_low_15
Description: NF9938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9938_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 66 - 123
Target Start/End: Complemental strand, 12640730 - 12640673
Alignment:
| Q |
66 |
atgcactacttgctcaacaaacaattggatgcaatcctaaatgacaaataataattgg |
123 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12640730 |
atgcaatacttgctcaacaaacaattggatgcaatactaaatgacaaataataattgg |
12640673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 115 - 181
Target Start/End: Complemental strand, 12639964 - 12639898
Alignment:
| Q |
115 |
aataattggacctatttatagtctttcattcaactcgttaaactttagtatacgtcttagagcataa |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||| | ||||| ||||||||| |
|
|
| T |
12639964 |
aataattggacctatttataatctttcattcaacttgttaaactttaggacccgtctcagagcataa |
12639898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 12642181 - 12642140
Alignment:
| Q |
13 |
aatatcaatccatgaataaaatctggatgcaatacttccaac |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12642181 |
aatatcaatccatgaataaaatctggatgcaatacttccaac |
12642140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 34343114 - 34343154
Alignment:
| Q |
174 |
gagcataactcagttggtaa-gacattgcataaaatatgta |
213 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
34343114 |
gagcataactcagttggtaaggacaatgcataaaatatgta |
34343154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 34707923 - 34707883
Alignment:
| Q |
174 |
gagcataactcagttggtaa-gacattgcataaaatatgta |
213 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
34707923 |
gagcataactcagttggtaaggacaatgcataaaatatgta |
34707883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University