View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9938_low_6 (Length: 276)
Name: NF9938_low_6
Description: NF9938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9938_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 36893366 - 36893111
Alignment:
| Q |
8 |
aagacattgaatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacagcgcttgctgtggcaaaggaaacaccagctacaa |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36893366 |
aagacatcgaatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacagcgcttgctgtggcaaaggaaacaccagctacaa |
36893267 |
T |
|
| Q |
108 |
gggcagatacaacagagcaggattccgatgtgtcttttagccattcgctactgtcttttataagacctttgtgtgttttcttgaaaatttctcttgatgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36893266 |
gggcagatacaacagagcaggattccgatgtgtcttttagccattcgctactgtcttttataagacctttgtgtgttttcttgaaaatttctcttgatgt |
36893167 |
T |
|
| Q |
208 |
tttgccactgctgttgtttctgaaaatgaagttttgtggcacaaggcttttgatgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36893166 |
tttgccactgctgttgtttctgaaaatgaagtgttgtggcacaaggcttttgatgt |
36893111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 36883354 - 36883110
Alignment:
| Q |
17 |
aatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacagcgcttgctgtggcaaaggaaacaccagctacaagggcagata |
116 |
Q |
| |
|
||||||||||||||||||||||| || || |||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
36883354 |
aatgcaggcttgccttctaatactggactgccttcatcggttgtgccgccaggtacttggcttgctgtggcaaaggaaacaccggctacaaggccagata |
36883255 |
T |
|
| Q |
117 |
caacagagcaggattccgatgtgtcttttagccattcgctactgtcttttataagacctttgtgtgttttcttgaaaatttctcttgatgttttgccact |
216 |
Q |
| |
|
| || ||||||||||| || |||||||||||||| ||| || |||| ||||||| || ||||||| ||||||||||||| |||||||||||||| | |
|
|
| T |
36883254 |
cgacggagcaggattctgacgtgtcttttagccaactgctgctctcttgtataagattttcgtgtgttgtcttgaaaatttcacttgatgttttgccctt |
36883155 |
T |
|
| Q |
217 |
gctgttgtttctgaaaatgaagttttgtggcacaaggcttttgat |
261 |
Q |
| |
|
| ||||| |||| || ||||| |||||| |||||||||||||| |
|
|
| T |
36883154 |
gttgttgcttctaaagtagaagtgttgtggtacaaggcttttgat |
36883110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 36903175 - 36903003
Alignment:
| Q |
1 |
aaagaggaagacattgaatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacagcgcttgctgtggcaaaggaaacacca |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| | ||||||| ||||||||||| || |||| ||||| |||||| ||||| |
|
|
| T |
36903175 |
aaagaggaagacattgaatgcaggattgccttctaatactggtctaccct---cagttgttccgccaggtactgcacttgttgtggtgaaggaagcacca |
36903079 |
T |
|
| Q |
101 |
gctacaagggcagatacaacagagcaggattccgatgtgtcttttagccattcgctactgtcttttataagacctt |
176 |
Q |
| |
|
|| ||||| || | |||||| |||||||| || | ||||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
36903078 |
gcgacaagcgcggctacaaccgagcaggaatctgctgtgttttttagccattcattgctgtcttttataagacctt |
36903003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University