View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9938_low_7 (Length: 271)
Name: NF9938_low_7
Description: NF9938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9938_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 2 - 254
Target Start/End: Complemental strand, 28525410 - 28525158
Alignment:
| Q |
2 |
tcgagtttggtgttgtccatgtgtactatatatgtttgctgcgccgagagagcaactgaatttgtcaccataagagccaggaatagaaagactatcctga |
101 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28525410 |
tcgattttggtcttgtccatgtgtactatatatgtttgctgcgccgagagagcaactgaatttgtcaccataagagccaggaatagaaagactatcctga |
28525311 |
T |
|
| Q |
102 |
atatcatgatgcctgcaagaaaatgaagagaggaacaattcatggctagtgttaggatctaaatatctgtgaaagaatcaatcttctcatgcaacaaaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28525310 |
atatcatgatgcctgcaagaaaatgaagagaggaacaattcatggctagtgttaggatctaaatatctgtgaaagaatcaatcttctcatgcaacaaaaa |
28525211 |
T |
|
| Q |
202 |
taaaataggaaaaagtatagtattccatttcaaaacttctatagactactttt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28525210 |
taaaataggaaaaagtatagtattccatttcaaaacttctatagactactttt |
28525158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University