View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9939_low_14 (Length: 239)
Name: NF9939_low_14
Description: NF9939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9939_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 18303475 - 18303697
Alignment:
| Q |
1 |
tattggatgacccacataaccaatactttgccttagtctcccaacattgtattccactcttctcgtttcgatttgtttataactccctttttgaaaatcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18303475 |
tattggatgacccacataaccaatactttgccttagtctcccaacattgtattccactcttctcgtttcgatttgtttataactccctttttgaatatcg |
18303574 |
T |
 |
| Q |
101 |
ggtagagtccttaatcaagtacaagattcaacaccctagcttcattgagtttgactctaaacatccgaatctctaccagcgctataatgctcgtggaaag |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18303575 |
ggtagagtccttaaacaagtacaagattcaacaccctagcttcattgagtttgactctaaacatccgaatctctaccagcgctataatgctcgtggaaag |
18303674 |
T |
 |
| Q |
201 |
gatgtaatgatgccggaggtttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18303675 |
gatgtaatgatgccggaggtttc |
18303697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 18340214 - 18340132
Alignment:
| Q |
17 |
taaccaatactttgccttagtctcccaacattgtattccactcttctcgtttcgatttgtttataactccctttttgaaaatc |
99 |
Q |
| |
|
|||||||||||||||| |||| || ||||| ||| |||| ||||| ||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
18340214 |
taaccaatactttgccctagtttctcaacactgtgttccgctcttgtcgtttcgattcgtttataactacctttttaaaaatc |
18340132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 99
Target Start/End: Complemental strand, 18345383 - 18345290
Alignment:
| Q |
6 |
gatgacccacataaccaatactttgc-cttagtctcccaacattgtattccactcttctcgtttcgatttgtttataactccctttttgaaaatc |
99 |
Q |
| |
|
|||||||||| |||||||||||||| |||| ||||||||| |||||||||||||||||| |||| ||| ||||||||| ||||||| |||||| |
|
|
| T |
18345383 |
gatgacccactgaaccaatactttgcactta-tctcccaacgttgtattccactcttctcatttcaattcatttataactacctttttaaaaatc |
18345290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 18340089 - 18340001
Alignment:
| Q |
133 |
accctagcttcattgagtttgactctaaacatccgaatctctaccagcgctataatgctcgtggaaaggatgtaatgatgccggaggtt |
221 |
Q |
| |
|
|||||||||| |||||| || |||| | |||||||||||||| |||| ||||| ||||||||| || |||| ||| ||||||||||| |
|
|
| T |
18340089 |
accctagctttattgagattctctctgaggatccgaatctctacgagcgttataacgctcgtggagagaatgttatgttgccggaggtt |
18340001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 18345197 - 18345159
Alignment:
| Q |
183 |
tataatgctcgtggaaaggatgtaatgatgccggaggtt |
221 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18345197 |
tataatgctcgtggagagaatgtaatgatgccggaggtt |
18345159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University