View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9940_high_12 (Length: 269)
Name: NF9940_high_12
Description: NF9940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9940_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 5960633 - 5960385
Alignment:
| Q |
1 |
aaattattagtattgctctctaatctcaagttggtgtgttgttggagtttatatgtgggtatgaaattaatgattatggtttagaaagtgtcacgatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5960633 |
aaattattagtattgctctctaatctcaagttggtgtgttgttggagtttatatgtgggtatgaatttaatgattatggtttagaaagtgtcacgatgag |
5960534 |
T |
|
| Q |
101 |
ggggttaaatagaatgtaaagtgatgactttaacgggtctgggaaagccaaagacttttcgagaggatggacaagtgaactttttagagacaaagtgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960533 |
ggggttaaatagaatgtaaagtgatgactttaacgggtctgggaaagccaaagacttttcgagaggatggacaagtgaactttttagagacaaagtgaca |
5960434 |
T |
|
| Q |
201 |
cttgcaaccggtaatttttatagaaaatacctgaagcaaatcctattct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960433 |
cttgcaaccggtaatttttatagaaaatacctgaagcaaatcctattct |
5960385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University