View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9940_high_15 (Length: 240)
Name: NF9940_high_15
Description: NF9940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9940_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 6020803 - 6021005
Alignment:
| Q |
19 |
cctagccctagccctgcttacactttgatggttagttttattatatcacattcttggnnnnnnncctacacatgatcatgcagtgcaatggataagacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6020803 |
cctagccctagccctgcttacactttgatggttagttttattatatcacattcttggtttttt-cctacacatgatgatgcagtgcaatggataagacaa |
6020901 |
T |
 |
| Q |
119 |
atggagagaagattttgatatgggccccgcaaaaaacacaagagatagccaatattttgccattcatttttctctctaaaacaatagaaaatgatcgtag |
218 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6020902 |
atggagggaagattttgacatgggccccgcaaaaaacacaagagatagccaatattttgccattcatttttctctctaaaacaatagaaaatgatcgtag |
6021001 |
T |
 |
| Q |
219 |
tggg |
222 |
Q |
| |
|
|||| |
|
|
| T |
6021002 |
tggg |
6021005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University