View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9941_8 (Length: 302)
Name: NF9941_8
Description: NF9941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9941_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 11 - 295
Target Start/End: Complemental strand, 44851481 - 44851197
Alignment:
| Q |
11 |
aatgatgtcctctgagcagtgtgttgtagattgtaagtaatgaaaattttcttcatttgtaacttgatcactactactcacagtgctcttattactgtta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851481 |
aatgatgtcctctgagcagtgtgttgtagattgtaagtaatgaaaattttcttcatttgtaacttgatcactactactcacagtgctcttattactgtta |
44851382 |
T |
|
| Q |
111 |
atctcctcttctacctgtttctgttcttggttttcttccttagaagtaactgggagatctttggttgtttcggttttggattcttttggttgttgagcta |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851381 |
atctcctcttctacctgtttttgttcttggttttcttccttagaagtaactgggagatctttggttgtttcggttttggattcttttggttgttgagcta |
44851282 |
T |
|
| Q |
211 |
aatttgtggtggaggagagggcagtgggatctggatggttatgtgttgaagtataggtgatgatgagcaatgaagcatctgtgct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851281 |
aatttgtggtggaggagagggcagtgggatctggatggttatgtgttgaagtataggtgatgatgagcaatgaagcatctgtgct |
44851197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University