View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9941_low_7 (Length: 286)
Name: NF9941_low_7
Description: NF9941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9941_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 278
Target Start/End: Complemental strand, 29281085 - 29280823
Alignment:
| Q |
16 |
gtttaatcctctccaaatctctacacgaccgtgttaaagtacttcactcgtcgttcattggttcacttgctgattcacgaaaccctaacgttcaagttgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281085 |
gtttaatcctctccaaatctctacacgaccgtgttaaagtacttcactcgtcgttcattggttcacttgctgattcacgaaaccctaacgttcaagttgc |
29280986 |
T |
|
| Q |
116 |
atcatttggtgcagtggtgagcctgattcgtttgttttcagatccatcactttttcacgaactacttcgagccatgatggtcggtgtattttcactcttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280985 |
atcatttggtgcagtggtgagcctgattcgtttgttttcagatccatcactttttcacgaactacttcgagccatgatggtcggtgtattttcactcttg |
29280886 |
T |
|
| Q |
216 |
caaggatatgaaagaagctacttcaaaagcgcttttgcagagttggttaagcttgtctctgct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29280885 |
caaggatatgaaagaagctacttcaaaagcgcttttgcagagttggttaagcttgtgtctgct |
29280823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University