View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9943_high_12 (Length: 209)

Name: NF9943_high_12
Description: NF9943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9943_high_12
NF9943_high_12
[»] chr2 (1 HSPs)
chr2 (21-191)||(1608422-1608592)


Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 21 - 191
Target Start/End: Complemental strand, 1608592 - 1608422
Alignment:
21 agggcttatgtggtttagttgatttagacatgtatgtttgtcacaaatgtattttctttactactcaagattggagtttgatgaagtcagaaagaatata 120  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
1608592 agggcttatgtggtttagttgatttaggcatgtatgtttgtcacaaatgtattttctttactactcaaaattggagtttgatgaagtcagaaagaatata 1608493  T
121 tctgtgcaaaatttgatattttgttgcaaaaatgttaaacttctcctgttctttgcattgacagtttatct 191  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
1608492 tctgtgcaaaatttgatattttgttgcaaaaaagttaaacttctcctgttctttgcattgacagtttatct 1608422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University