View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9943_low_12 (Length: 234)

Name: NF9943_low_12
Description: NF9943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9943_low_12
NF9943_low_12
[»] chr7 (5 HSPs)
chr7 (24-216)||(6889664-6889859)
chr7 (24-216)||(6844669-6844858)
chr7 (111-216)||(6849107-6849210)
chr7 (6-113)||(6849371-6849478)
chr7 (25-140)||(30597579-30597694)
[»] scaffold0210 (1 HSPs)
scaffold0210 (178-217)||(15863-15902)
[»] chr6 (2 HSPs)
chr6 (175-216)||(8656155-8656196)
chr6 (176-216)||(7174891-7174931)
[»] chr3 (1 HSPs)
chr3 (176-216)||(7058317-7058357)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 24 - 216
Target Start/End: Complemental strand, 6889859 - 6889664
Alignment:
24 atcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaaga 123  Q
    |||||| |||||||||||||  ||||| |||||||||||| ||||| ||||| ||||| |||||| | | ||  ||||| ||||||||||||||||||||    
6889859 atcaatctttacatgtttgacagaagagagattgctctctatcccatgtagtttcagagcaggaaaacctccgatacaaacaaagacaaaggtgcaaaga 6889760  T
124 cttggagtagataactcgattttgccatattggt--ggtgatacact-tttaaagttaaattggcaagtgtagcacttgatatgcagaggttttgt 216  Q
    ||||||||||||||||||||||||||||| | ||  |   |  || | | |||||||||||||||||||||||||||| |||| ||||||||||||    
6889759 cttggagtagataactcgattttgccataattgtaggcccaaccagtgtctaaagttaaattggcaagtgtagcacttaatatccagaggttttgt 6889664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 24 - 216
Target Start/End: Complemental strand, 6844858 - 6844669
Alignment:
24 atcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaaga 123  Q
    |||||| |||||||||||||  ||||| ||||| |||||| ||||| ||||| ||||| ||||||||| |||   |||| ||||||||||||||||||||    
6844858 atcaatctttacatgtttgacagaagagagatttctctctatcccatgtagtttcagagcaggaatattcccctcacaaacaaagacaaaggtgcaaaga 6844759  T
124 cttggagtagataactcgattttgccatattggtggtgatacacttttaaagttaaattggcaagtgtagcacttgatatgcagaggttttgt 216  Q
    ||||||||||||||||| |||||| ||||||  | ||| |    || || ||||||||   ||||||||||||||||||| ||||||||||||    
6844758 cttggagtagataactcaattttgtcatatttattgtgtt---tttctatagttaaatcatcaagtgtagcacttgatatacagaggttttgt 6844669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 111 - 216
Target Start/End: Complemental strand, 6849210 - 6849107
Alignment:
111 aaaggtgcaaagacttggagtagataactcgattttgccatattggtggtgatacacttttaaagttaaattggcaagtgtagcacttgatatgcagagg 210  Q
    |||||||||||||||||||||||||||||||||| ||||  ||| || |||||||  |||||||||||||||||||||||||||||||||||||||||||    
6849210 aaaggtgcaaagacttggagtagataactcgattatgccg-attagtagtgatacg-ttttaaagttaaattggcaagtgtagcacttgatatgcagagg 6849113  T
211 ttttgt 216  Q
    ||||||    
6849112 ttttgt 6849107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 6 - 113
Target Start/End: Complemental strand, 6849478 - 6849371
Alignment:
6 aatacaccccatacatagatcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaacca 105  Q
    |||| ||||||||  || |||||||||||||||||||| |||||| |||||||||||||||||||||||| | |||| |||||||||||| |||||||||    
6849478 aatagaccccatatttaaatcaatatttacatgtttgacggaagagagattgctctctctcccacgtagttttagattaggaatatcccccgtacaacca 6849379  T
106 aagacaaa 113  Q
    ||||||||    
6849378 aagacaaa 6849371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 140
Target Start/End: Original strand, 30597579 - 30597694
Alignment:
25 tcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaagac 124  Q
    |||||||||||||||||||  ||||| || ||| | |  |||| || |||| ||| | |||||||| || |   |||| ||||| |||||||| ||||||    
30597579 tcaatatttacatgtttgacagaagagaggttgattttgctcctacatagtttcaaaacaggaataccctcataacaaacaaagtcaaaggtgaaaagac 30597678  T
125 ttggagtagataactc 140  Q
    ||||||||||||||||    
30597679 ttggagtagataactc 30597694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 217
Target Start/End: Original strand, 15863 - 15902
Alignment:
178 aaattggcaagtgtagcacttgatatgcagaggttttgtg 217  Q
    |||||||||||||| |||||||||||| ||||||||||||    
15863 aaattggcaagtgtggcacttgatatgtagaggttttgtg 15902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 8656155 - 8656196
Alignment:
175 gttaaattggcaagtgtagcacttgatatgcagaggttttgt 216  Q
    ||||||||||  ||||| ||||||||||||||||||||||||    
8656155 gttaaattggtgagtgtggcacttgatatgcagaggttttgt 8656196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 7174891 - 7174931
Alignment:
176 ttaaattggcaagtgtagcacttgatatgcagaggttttgt 216  Q
    ||||||||||||||||  ||||||||||||||| |||||||    
7174891 ttaaattggcaagtgtgacacttgatatgcagatgttttgt 7174931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 7058317 - 7058357
Alignment:
176 ttaaattggcaagtgtagcacttgatatgcagaggttttgt 216  Q
    |||||||||||||||| ||||| |||||| |||||||||||    
7058317 ttaaattggcaagtgtggcactcgatatgtagaggttttgt 7058357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University