View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9944_2 (Length: 360)
Name: NF9944_2
Description: NF9944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9944_2 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 26 - 360
Target Start/End: Original strand, 47116799 - 47117118
Alignment:
| Q |
26 |
gttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116799 |
gttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaa |
47116898 |
T |
|
| Q |
126 |
taaccaatttcttttatatctttagtttcaattcaaggagataaatattcatacctcttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116899 |
taaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtat |
47116998 |
T |
|
| Q |
226 |
caatgagatggacatcatcagatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaag |
325 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116999 |
caatga---------------ctcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaag |
47117083 |
T |
|
| Q |
326 |
ctcaacgggaacgccaacatcaccatcttcgccgg |
360 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47117084 |
ctcaacgggaacgccaacatcaccgtcttcaccgg |
47117118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University