View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9945_high_2 (Length: 441)
Name: NF9945_high_2
Description: NF9945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9945_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 250 - 432
Target Start/End: Complemental strand, 52391653 - 52391477
Alignment:
| Q |
250 |
tgtacaagatttccacattccctcctatattttccacctctgaagccatcccttctcataccttttaaactctcaaaattggaacagaattcctgttcca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
52391653 |
tgtacaagatttccacattccctcctatattttccaactctgaagtcatcccttctcatacctttcaaactctcaaaattggaacagg------gttcca |
52391560 |
T |
 |
| Q |
350 |
acttgaagagggaatcttattagtgatattacaaaaactaatgatgattggaggctaaattttttatgttccttttccctttg |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391559 |
acttgaagagggaatcttattagtgatattacaaaaactaatgatgattggaggctaaattttttatgttccttttccctttg |
52391477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 52393099 - 52393037
Alignment:
| Q |
149 |
ctgctaaacaactagtcttatcttttagtaaaagtacttctatgcttcgtcatttaatcttgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52393099 |
ctgctaaacaactagtcttatcttttagtaaaagtacttctatgcttcgtcatttaatcttgt |
52393037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 63 - 107
Target Start/End: Complemental strand, 52393166 - 52393122
Alignment:
| Q |
63 |
ttgtcttgccctagttctattggcaaattgcatcctctagtgtct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52393166 |
ttgtcttgccctagttctattggcaaattgcatcctctagtgtct |
52393122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University