View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9945_low_8 (Length: 232)
Name: NF9945_low_8
Description: NF9945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9945_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 28722628 - 28722471
Alignment:
| Q |
21 |
agcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccgcggttgcagtcttgcaggaggtgaactacgttttggctttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722628 |
agcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccacggttgcagtcttgcaggaggtgaactacgttttggctttt |
28722529 |
T |
 |
| Q |
121 |
ccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722528 |
ccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
28722471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University