View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9945_low_8 (Length: 232)

Name: NF9945_low_8
Description: NF9945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9945_low_8
NF9945_low_8
[»] chr3 (1 HSPs)
chr3 (21-178)||(28722471-28722628)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 28722628 - 28722471
Alignment:
21 agcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccgcggttgcagtcttgcaggaggtgaactacgttttggctttt 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
28722628 agcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccacggttgcagtcttgcaggaggtgaactacgttttggctttt 28722529  T
121 ccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28722528 ccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc 28722471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University