View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9946_high_3 (Length: 264)
Name: NF9946_high_3
Description: NF9946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9946_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 15253317 - 15253055
Alignment:
| Q |
1 |
tggctgtggataaatctcttagaaggtataaaaacattacacatgctttaaggctttatttgcatttgttggattagtttggttaccaatataat-tata |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
15253317 |
tggctgtggataaatctcttagaaggtataaaaacattacacatgctttaaggcttgatttgcatttgttggattagtttggttaccgatagaatgtata |
15253218 |
T |
 |
| Q |
100 |
gttgatttgaagagtgaatagggaaattgttggttgatattgggaggattgattaatatagtctctgaattttacgaatttacaattacatcgttaaaa- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15253217 |
gttgatttgaagagtgaatagggaaattagtggttgatattgggtggattgattaatatagtctctgaattttacgaatttacaattacatcgttaaaat |
15253118 |
T |
 |
| Q |
199 |
-------ttgttgcgtgttagtcaaaatagtttattcgttaacttctactattagagcctatg |
254 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15253117 |
tgtagcattgtagcgtgttagtcaaaatagtttattcgttaacttctactattagagcctatg |
15253055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University