View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9949_low_1 (Length: 401)
Name: NF9949_low_1
Description: NF9949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9949_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 30770494 - 30770775
Alignment:
| Q |
19 |
cctgcaacatcaacaatggcttttggtggagttgttgctgctactagtggtgatgttaatgtgaatagggttgtttctgatgatgagagatcagattatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770494 |
cctgcaacatcaacaatggcttttggtggagttgttactgctactagtggtgatgttaatgtgaatagggttgtttctgatgatgagagatcagattatg |
30770593 |
T |
|
| Q |
119 |
gaggattaatcggatctcgaaaaccgcctttgccattgcagcttggtcaaccaaggactagtggtggtgtgagtcttccttcaccagattcagttacaag |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30770594 |
gaggattaatcggatctcgaaaacctcctttaccgttgcagcttgttcaaccaaggactagtggtggtgtgagtcttccatcaccagattcagttacaag |
30770693 |
T |
|
| Q |
219 |
gtatggttggttatgctttgtgtaacattactctctttttggttcttttttcatgtcatagttgtttcttgcttcctttgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30770694 |
gtatggttggttatgctttgtgtaacattactctctttttggttcttttttcatgtcatagttgtttcttgcttcttttgct |
30770775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University