View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9949_low_4 (Length: 244)
Name: NF9949_low_4
Description: NF9949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9949_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 91 - 227
Target Start/End: Complemental strand, 10124076 - 10123941
Alignment:
| Q |
91 |
ctgcagactctaatttaatgaatttatatttggaaacgtatttcttatgggttcaccaaaagtacaatattaatctgtatatgatttttgtatatgtttt |
190 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124076 |
ctgcagactctattttta-gaatttatatttggaaacgtatttcttatgggttcaccaaaagtacaatattaatctgtatatgatttttgtatatgtttt |
10123978 |
T |
 |
| Q |
191 |
gtttctgaatccggttaaattctccttgtatacaatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10123977 |
gtttctgaatccggttaaattctccttgtatacaatg |
10123941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University