View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9949_low_5 (Length: 243)
Name: NF9949_low_5
Description: NF9949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9949_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 436976 - 437201
Alignment:
| Q |
1 |
tcttcattactttatcactatgagcaaatctactattttagatccaaacggtggacccttgcatcttctggtttgtgcatttaaacgaaattgtttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436976 |
tcttcattactttatcactatgagcaaatctactattttagatccaaacggtggacccctgcatcttctggtttgtgcatttaaacgaaattgtttattt |
437075 |
T |
|
| Q |
101 |
gaaaatgaattttttgttagttcatcatgctctaatgt-aaaattgcaattgcactttttcagatgctttgcagaatcaatcaaccatgtcagttccagc |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437076 |
gaacatgaattttttgttagttcatcatgctctaatgtaaaaattgcaattgcactttttcagatgctttgcagaatcaatcaaccatgtcagttccagc |
437175 |
T |
|
| Q |
200 |
ttcaataacacagtttttgcagcctt |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
437176 |
ttcaataacacagtttttgcagcctt |
437201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University