View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9950_high_4 (Length: 324)
Name: NF9950_high_4
Description: NF9950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9950_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 28711648 - 28711416
Alignment:
| Q |
1 |
taaaatgtagtagctccccattgaaaaggatatggaaccacatatgggatagaatcagttaagtggtttcatttcatgatatgtttattgtgcacttttc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28711648 |
taaaatgtaggagctccccattgaaaaggatatggaaccacatatgggatagaatgagttaagtggtttcat-----gatatgtttattgtgcacttttc |
28711554 |
T |
 |
| Q |
101 |
ttccatggaagttatgttcaactttgagatagaatccaaatgcggtttgtcatgtactatgttctcgtatacttccggcaagt--taaacctgcaccaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
28711553 |
ttccatggaagttatgttcaactttgagatagaatccaaatgcggtatttcatgtactatgttctcgtatacttccggcaagttataaacctg------c |
28711460 |
T |
 |
| Q |
199 |
accaacaccaaatagactctcttaattcattaaatttcttcccg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711459 |
accaacaccaaatagactctcttaattcattaaatttcttcccg |
28711416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 272 - 307
Target Start/End: Complemental strand, 28711386 - 28711351
Alignment:
| Q |
272 |
gtatgctcaagtgactacttcaaaataactttaaat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711386 |
gtatgctcaagtgactacttcaaaataactttaaat |
28711351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University