View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9950_high_7 (Length: 252)
Name: NF9950_high_7
Description: NF9950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9950_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 8240984 - 8240803
Alignment:
| Q |
13 |
caaagggaaggaaaaaca-aatgttgtggaacccacatctagagtctttcttcttatatttgaacggaaagtgtggatataaaaggacctttttagttga |
111 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8240984 |
caaaggaaaggaaaaacagaatattgtggaacctgcatctagagtctttcctctcatatttggacggaaagtgtggatataaaaggaccattttagttga |
8240885 |
T |
 |
| Q |
112 |
aattacttnnnnnnnnctcaaattgttgcaattttataaagaaaagggttatgctaacttgtaccctaaggacccaagttaag |
194 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8240884 |
aattactt-aaaaaaactcaaattgttgcaatttaataaagaaaagggttatgctaacttgtaccctaaggacccaagttaag |
8240803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University